Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Mass Spectrometry, Flow Cytometry, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Transfection, Plasmid Preparation, Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: RNA Sequencing Assay, Over Expression

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Over Expression, Immunoprecipitation, Western Blot, Functional Assay, Transfection, Plasmid Preparation, Migration, shRNA, Luciferase

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: In Vitro, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Migration

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Inhibition, Over Expression, Expressing, Western Blot

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: Two vector control cell lines (VC1 and VC2) and two UGDH-overexpressing lines (OE1 and OE2) were selected in the LNCaP AD background. Equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing DMSO (vehicle, 0 nM) or the indicated concentration of DHT. After an additional 48 hours, cells were harvested for analysis. AR-dependent genes PSA ( A ) and UGT2B17 ( B ) were analyzed by WB in whole cell lysates; ( C ) functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates; ( D ) UDP-sugar pools were measured in cell lysates by LC-MS. In panels A–C, mean ± SEM is plotted for triplicate measurements. In panel D, mean ± SD is plotted for quadruplicate measurements. Statistical significance is indicated as: (a) p < 0.05 relative to VC1 at 0 nM DHT. (b) p < 0.05 relative to VC2 at 0 nM DHT. (c) p < 0.05 comparing OE1 to both VC1 and VC2 at the indicated [DHT]. (d) p < 0.05 comparing OE2 to both VC1 and VC2 at the indicated [DHT].

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Concentration Assay, Functional Assay, Expressing, Liquid Chromatography with Mass Spectroscopy

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: Two vector control cell lines (VC1 and VC2) and two UGDH-overexpressing lines (OE1 and OE2) were selected in the LNCaP CR background. Equal cell numbers were seeded 48 hours in androgen replete media followed by harvest of cells for analysis of gene expression ( A and B ) and UDP-sugars ( D ). For panel ( C ), equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing DMSO (vehicle, 0 nM) or the indicated concentration of DHT. After an additional 48 hours, cells and media were harvested for analysis. AR-dependent genes UGT2B17 (A) and FoxA1 (B) were analyzed by WB in whole cell lysates; (C) functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates; (D) UDP-sugar pools were measured in cell lysates by mass spectrometry. Mean ± SEM is plotted for triplicate technical measurements; * p < 0.05 for OE1 and OE2 relative to VC1 and VC2.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Expressing, Concentration Assay, Functional Assay, Mass Spectrometry

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: LNCaP AD and CR cells were selected for stable expression of a non-targeting vector control (VC1 and VC2) or a UGDH shRNA knockdown construct (KD1 and KD2). Equal cell counts were seeded 48 hours in androgen depleted media, followed by removal and replacement with media containing 10 nM DHT or DMSO (vehicle, 0 nM). After an additional 48 hours, cells were harvested for analysis by western blot and mass spectrometry. ( A ) AR-dependent genes PSA (panels a and d ) and UGT2B17 (panels b and e ) were analyzed by WB in whole cell lysates; functional synthetic output of each cell line was assessed by Notch1 expression in cell lysates (panels c and f ). Panels (a–c) depict expression data in the AD background and panels (d–f) illustrate data from the CR background. Mean ± SEM is plotted. Statistical significance is indicated on the plots as: (a) p < 0.05 for that clone, comparing 0 vs 10 nM DHT; (b) p < 0.05 relative to VC1 and VC2, 10 nM DHT; (c) p < 0.05 relative to VC1 and VC2, 0 nM DHT. ( B ) UDP-sugar pools were measured in cell lysates by LC-MS for both the AD (upper) and CR (lower) backgrounds as indicated. Mean ± SD is plotted. Statistical significance is indicated as: (a) p < 0.05 for both KD1 and KD2 relative to VC1 or VC2, 0 nM DHT. (b) p < 0.05 for both KD1 and KD2 relative to VC1 or VC2, 10 nM DHT. (c) p < 0.05 for that clone, comparing 0 and 10 nM DHT.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Expressing, Plasmid Preparation, shRNA, Construct, Western Blot, Mass Spectrometry, Functional Assay, Liquid Chromatography with Mass Spectroscopy

Journal: Oncotarget

Article Title: Altered glucuronidation deregulates androgen dependent response profiles and signifies castration resistance in prostate cancer

doi: 10.18632/oncotarget.28059

Figure Lengend Snippet: ( A and B ) LNCaP AD cells overexpressing UGDH (B) were compared to vector control (A) and to LNCaP CR cells with UGDH knocked down ( C , Control; D , UGDH KD). Equal cell numbers were plated and treated for three days with the indicated concentrations of enzalutamide (in mM). Proliferating cells were quantified in a fluorescence plate reader using resazurin-resorufin conversion. Daily cell count was determined from a standard curve and represents the mean of four technical replicates ± SEM; * p < 0.05.

Article Snippet: To achieve UGDH knockdown, LNCaP AD and LNCaP CR cells were transfected with plasmids encoding shRNA targeted to UGDH or a scrambled non-targeting control (UGDH shRNA-pGFP-V-RS #TG334012 and 29-mer oligo-pGFP-V-RS #TR30008, respectively, from Origene Technologies, Rockville, MD, USA).

Techniques: Plasmid Preparation, Fluorescence, Cell Counting